Shall I Compare Thee to a Summer’s DNA?

dna

Digital information encoding in DNA.

Using DNA as a data storage medium might sound like science fiction, but it’s not. Today Nature published this account of how scientists at the European Bioinformatics Institute in the UK have done just that. Unfortunately the article is not open access. The scientists successfully encoded an MP3 file — along with a digital photo and all 154 of Shakespeare’s sonnets — into DNA, with an astounding storage density of 2.2 petabytes per gram. How did they do it?

The scientists developed a code that used the four molecular letters or “bases” of genetic material – known as G, T, C and A – to store information. Digital files store data as strings of 1s and 0s. The Cambridge team’s code turns every block of eight numbers in a digital code into five letters of DNA. For example, the eight digit binary code for the letter “T” becomes TAGAT. To store words, the scientists simply run the strands of five DNA letters together. So the first word in “Thou art more lovely and more temperate” from Shakespeare’s sonnet 18, becomes TAGATGTGTACAGACTACGC

Read more about this story on The Guardian.

Join the discussion on Google+.

You may also like...

Leave a Reply

Your email address will not be published. Required fields are marked *